• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    the present disclosure relates to a variant of adenyl succinate synthetase, a microorganism containing the same and a method for preparing purine nucleotides using the microorganism.
    公开号:BR112019014131A2
    申请号:R112019014131-6
    申请日:2018-08-23
    公开日:2020-03-10
    发明作者:Ji Baek Min；Hye Lee Ji；Park So-Jung；Yeon Bae Jee
    申请人:Cj Cheiljedang Corporation；
    IPC主号:
    专利说明:

    Invention Patent Descriptive Report for “ADENYL SUCCINATE SYNTHETASE VARIANT, POLYNUCLEOTIDE, VECTOR, MICROORGANISM OF THE GENERY CORYNEBACTERIUM AND METHOD FOR PREPARING PURINE NUCLEOTIDES” [TENNIS OF THIS TECHNIQUE] refers to a new technical reference] [001 adenyl succinate, a microorganism that contains the same and a method for preparing purine nucleotides using the microorganism.
    [BACKGROUND TO THE TECHNIQUE] [002] 5'-Inosine monophosphate (hereinafter, IMP), a nucleic acid based material, is an intermediate of the nucleic acid biosynthetic metabolic system used in various fields (for example, medicines , various medical applications, etc.) and a material widely used as a food or food additive together with 5'-guanine monophosphate (hereinafter, GMP). It is known that the IMP itself produces a meat flavor and enhances the taste of monosodium glutamic acid (MSG) like GMP, thus attracting the public's attention as flavor-based nucleic acid seasoning.
    [003] Methods of preparing IMP may include a method of enzymatically degrading ribonucleic acid extracted from yeast cells, a method of chemical phosphorylation of inosine produced by fermentation (Agri. Biol. Chem., 36.1511 (1972), etc. .), a method to grow a microorganism that directly produces IMP and to recover IMP from the cultivated medium, etc. Among these methods, the most widely used method is that of using a microorganism capable of directly producing the IMP.
    [004] Additionally, the method of preparing GMP may include a method of converting 5 'xanthosin monophosphate (hereinafter, XMP) produced by microbial fermentation into GMP using a corniform microorganism and a method of converting XMP produced by fermentation microbial in GMP using Escherichia coli. In the above methods, when GMP is produced by a
    Petition 870190063824, of 07/08/2019, p. 10/55
    2/40 method in which XMP is produced first and then converted to GMP, the productivity of XMP (ie, a precursor to the conversion reaction during microbial fermentation) needs to be increased, and additionally, both the produced XMP and GMP already produced during the entire conversion reaction process must be protected from being lost.
    [005] However, since enzymes in nature do not always exhibit optimal properties in terms of activity, stability, substrate specificity for optical isomers, etc. in industrial applications, several attempts have been made to improve enzymes to achieve the desired use by varying their amino acid sequences. Among these, rational design and enzyme-directed site mutagenesis have been applied to improve enzyme functions in some cases; however, these methods have disadvantages in that information about the structure of the target enzyme is not sufficient or the correlation between structure and function is unclear and, therefore, cannot be effectively applied. In this case, it has been reported that the activity of an enzyme can be increased by improving the enzyme through a directed evolution method, in which the enzymes of the desired characteristics are searched from a mutant library of enzymes constructed through random variations of enzymatic genes. The inventors of the present disclosure have carried out extensive research for the production of high-purine nucleotide yields through a method for producing purine nucleotides that contain IMP or XMP through microbial fermentation. As a result, they revealed protein variants with higher purine nucleotide productivity, thus completing the present disclosure.
    [REVELATION] [TECHNICAL PROBLEM] [006] An objective of the present disclosure is to provide a variant of adenyl succinate synthetase.
    [007] Another objective of the present disclosure is to provide a polynucleotide that encodes the adenyl succinate synthase variant.
    Petition 870190063824, of 07/08/2019, p. 11/55
    3/40 [008] Yet another object of the present disclosure is to provide a vector that contains the polynucleotide.
    [009] Yet another objective of the present disclosure is to provide a microorganism capable of producing purine nucleotides, which contains the adenyl succinate synthase variant and the vector.
    [010] Yet another objective of the present disclosure is to provide a method for preparing purine nucleotides, which includes cultivating the microorganism of the genus Corynebacterium in a medium; and recovering the purine nucleotides from the microorganism or medium.
    [TECHNICAL SOLUTION] [011] Later in this document, exemplary modalities of the present disclosure will be described in detail. However, each of the explanations and exemplary modalities disclosed in this document can be applied to other explanations and exemplary modalities. That is, all combinations of various factors disclosed in the present document belong to the scope of the present disclosure. In addition, the scope of the present disclosure should not be limited by the specific disclosure provided below.
    [012] To achieve the above objectives, an aspect of the present disclosure provides a variant of adenyl succinate synthetase in which the 85 s N-terminal amino acid of the amino acid sequence of SEQ ID NO: 2 is replaced by a different amino acid. The modified adenyl succinate synthase has an amino acid modification at the 85 s position from the N-terminus of the amino acid sequence of SEQ ID NO: 2. Specifically, the present disclosure provides a variant of adenyl succinate synthase which has at least one amino acid variation in the amino acid sequence of SEQ ID NO: 2, wherein the modification includes a replacement of the 85 s position of the N-terminus by a different amino acid.
    [013] As used here, the term adenyl succinate synthase refers to an enzyme that plays an important role in purine biosynthesis. For the purpose of the present disclosure, the enzyme refers to a protein involved in the
    Petition 870190063824, of 07/08/2019, p. 12/55
    4/40 purine nucleotide production that includes 5'-inosine monophosphate (IMP) or 5'-xanthosine monophosphate (XMP).
    [014] In the present disclosure, SEQ ID NO: 2 refers to an amino acid sequence that has adenyl succinate synthase activity. Specifically, SEQ ID NO: 2 is a protein sequence that has adenyl succinate synthase activity encoded by the purA gene. The amino acid sequence of SEQ ID NO: 2 can be obtained from the NCBI GenBank, which is a known database. In one embodiment, the amino acid sequence of SEQ ID NO: 2 can be derived from a microorganism of the genus Corynebacterium, but is not limited to this, and can include any sequence that has the same activity as the above amino acid sequence without limitation. In addition, the scope of the amino acid sequence of SEQ ID NO: 2 can include the amino acid sequence of SEQ ID NO: 2 which has the activity of adenyl succinate synthase or an amino acid sequence with 80% or more homology or identity with the amino acid sequence of SEQ ID NO: 2, but is not limited to that. Specifically, the above amino acid sequence can include the amino acid sequence of SEQ ID NO: 2 and / or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more of homology or identity with the amino acid sequence of SEQ ID NO: 2. The amino acid sequence that has homology or identity can be those in the above range, which excludes a sequence with 100% identity or it can be a string with less than 100% identity. In addition, it is evident that any protein that has an amino acid sequence that has a deletion, modification, substitution or addition in part of the sequence can also be used in the present disclosure as long as it has the homology or identity and exhibits corresponding effectiveness to that of the above protein.
    [015] In the present disclosure, the term "adenyl succinate synthase variant" can be used interchangeably with a polypeptide variant that has a purine nucleotide yield, a purine polypeptide that produces variant polypeptide, a polypeptide variant that produces nucleotides of
    Petition 870190063824, of 07/08/2019, p. 13/55
    5/40 purine, a variant of polypeptide that has the activity of adenyl succinate synthetase, a variant of adenyl succinate synthetase etc. Additionally, the protein can be derived from the Corynebacterium station's genus, but the protein is not limited to the same.
    [016] The adenyl succinate synthase variant includes a modification of the amino acid at the 85 s position from the N-terminus in the amino acid sequence of SEQ ID NO: 2. The adenyl succinate synthase variant is one in which the 85 s amino acid in the amino acid sequence of SEQ ID NO: 2 is replaced by a different amino acid. The adenyl succinate synthase variant can include the amino acid sequence of SEQ ID NO: 2 or it can be a weaker activity adenyl succinate synthase variant compared to a non-variant adenyl succinate synthase derived from a wild-type microorganism . Such a variant of adenyl succinate synthetase indicates the modification of the 85 s N-terminal amino acid in the amino acid sequence of SEQ ID NO: 2 or the amino acid sequence that has at least 80%, 85%, 90%, 95%, 96 %, 97%, 98% or 99% or more of homology or identity with the amino acid sequence of SEQ ID NO: 2, as explained above.
    [017] Specifically, the adenyl succinate synthase variant is one in which the 85 s amino acid in the amino acid sequence of SEQ ID NO: 2 is replaced by serine, alanine, valine, leucine, methionine, isoleucine, threonine, asparagine, glutamine , cysteine, tyrosine, lysine, aspartic acid or glutamic acid, and the adenyl succinate synthase variant may have weaker adenyl succinate synthase activity compared to that of a polypeptide that includes the amino acid sequence of SEQ ID NO: 2, but the adenyl succinate synthase variant is not limited to the same.
    [018] For the purpose of the present disclosure, when a microorganism includes the adenyl succinate synthase variant, the amount of purine nucleotide production that includes IMP or XMP is increased. This is significant as the present disclosure allows for an increase in the amount of IMP or XMP production
    Petition 870190063824, of 07/08/2019, p. 14/55
    6/40 through the adenyl succinate synthase variant of the present disclosure whereas the wild-type Corynebacterium strain cannot produce IMP or XMP, or can produce only a very small amount if IMP or XMP is produced. [019] The adenyl succinate synthase variant may include an amino acid sequence selected from the group of amino acid sequences where the 85 s amino acid from the N-terminus in the amino acid sequence of SEQ ID N s : 2 is replaced with a amino acid selected from the group consisting of serine, alanine, valine, leucine, methionine, isoleucine, threonine, asparagine, glutamine, cysteine, tyrosine, lysine, aspartic acid and glutamic acid. Specifically, the variant succinate adenylate synthetase may comprise a polypeptide comprising an amino acid sequence which is selected from the group of amino acid sequences of the 85 S amino acid of the N-terminal amino acid sequence of SEQ ID NO: 2 is replaced with an amino acid selected from the group consisting of serine, alanine, valine, leucine, methionine, isoleucine, threonine, asparagine, glutamine, cysteine, tyrosine, lysine, aspartic acid and glutamic acid. In addition, the adenyl succinate synthase variant may include an amino acid sequence where the 85 s N-terminal amino acid in the amino acid sequence of SEQ ID NO: 2 is replaced by a different amino acid, which has the amino acid sequence of the variant adenyl succinate synthase or an amino acid sequence with 80% or more homology or identity to the amino acid sequence of the adenyl succinate synthase variant, but the amino acid sequence is not limited to that. Specifically, the adenyl succinate synthase variant of the present disclosure can include a polypeptide with at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more of homology or identity with the amino acid sequence, where the 85 s amino acid in the amino acid sequence of SEQ ID NO: 2 is replaced with an amino acid selected from the group consisting of serine, alanine, valine, leucine, methionine, isoleucine, threonine, asparagine, glutamine, cysteine , tyrosine, lysine, aspartic acid and glutamic acid. In addition, it is evident that any amino acid sequence that has the homology or
    Petition 870190063824, of 07/08/2019, p. 15/55
    7/40 identity of the above sequence and which exhibits an effect corresponding to that of the protein must also be within the scope of the present disclosure, even if part of the amino acid sequence may be deleted, modified, substituted or added in part of the sequence, in addition to the amino acid 85 s position.
    [020] That is, although the present disclosure describes a protein or polypeptide that has the amino acid sequence of a particular SEQ ID NO, it is evident that a protein with an amino acid sequence with deletion, modification, substitution or addition in part of the sequence also can be used in the present disclosure, provided that the protein has identical or corresponding activity to that of the polypeptide comprised by an amino acid sequence of the corresponding SEQ ID NO. For example, as long as a protein has the same or corresponding activity as the polypeptide variant, it does not exclude the addition of sequences, the naturally occurring mutation, the silent mutation or its conservative substitution that does not alter the functions of the protein before and after the amino acid sequence. It is evident that a protein that has this addition of sequence or mutation also falls within the scope of the present disclosure.
    [021] Conservative substitution means the replacement of one amino acid with another amino acid with similar structural and / or chemical properties. Such amino acid substitution can generally occur based on similarity in the polarity of residues, charge, solubility, hydrophobicity, hydrophilic capacity and / or unsympathetic nature. For example, positively charged (basic) amino acids include arginine, lysine and histidine; and negatively charged amino acids (acids) include glutamic acid and aspartic acid; aromatic amino acids include phenylalanine, tryptophan and tyrosine; and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine and tryptophan.
    [022] Consequently, in the present disclosure, the variant may further include conservative substitution and / or modification of at least one amino acid in the protein or polypeptide that has an amino acid sequence of a particular SEQ ID NO. For example, certain variants may include variants where at least
    Petition 870190063824, of 07/08/2019, p. 16/55
    8/40 minus one part, such as an N-terminal initiation sequence or transmembrane domain, is removed. Other variants can include variants in which a part is removed from the N-terminus and / or the C-terminus of a mature protein. The variant may also include other modifications, including deletion or addition of amino acids, which have minimal effects on the properties and secondary structure of the polypeptide. For example, the polypeptide can be conjugated to a signal (or initiation) sequence at the N-terminus of a protein that directs co-translational or post-translational transfer of a protein. The polypeptide can also be conjugated to another sequence or a linker to facilitate identification, purification or synthesis of the polypeptide. The term "variant" can be used interchangeably with modification, modified protein, modified polypeptide, mutant, mutein, divergent, etc., and any term can be used without limitation, as long as it is used in the sense of being modified.
    [023] Homology and identity mean a degree of relationship between two given amino acid sequences or nucleotide sequences and can be expressed as a percentage.
    [024] The terms "homology" and "identity" can often be used interchangeably with each other.
    [025] The homology or sequence identity of a conserved polynucleotide or polypeptide can be determined by a standard alignment algorithm and the non-compliance interval penalties established by a program to be used can be used in combination. Substantially, homologous or identical sequences can hybridize under moderately or highly stringent conditions throughout their entire sequence or at least about 50%, about 60%, about 70%, about 80% or about 90% of all the length. As regards the polynucleotides to be hybridized, they can also be considered polynucleotides that include a degenerate codon instead of a codon.
    [026] Whether any two polynucleotide or polypeptide sequences have
    Petition 870190063824, of 07/08/2019, p. 17/55
    9/40 homology, similarity, or identity can be determined, for example, by a known computer algorithm, such as the “FASTA” program using predefined parameters, as in Pearson et al. (1988) (Proc. Natl. Acad. Sci. USA 85]: 2444). Alternatively, they can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443 to 453) as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276 to 277) (version 5.0.0 or higher) (which includes the GCG program package (Devereux, J., et al., Nucleic Acids Research 12: 387 ( 1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.] et al., J Molec Biol 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA /.] (1988) SIAM J Applied Math 48: 1073) For example, homology, similarity or identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information .
    [027] Homology, similarity or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program (eg, Needleman et al. (1970), J Mol Biol 48: 443) as revealed in Smith and Waterman, Adv. Appl. Math (1981) 2: 482. Briefly, the GAP program defines similarity as the number of aligned symbols (that is, nucleotides or amino acids) that are similar, divided by the total number of symbols in the lesser of the two sequences. Standard parameters for the GAP program can include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix (or EDNAFULL replacement matrix (EMBOSS version of NCBI NUC4.4)) by Gribskov et al. (1986) Nucl. Acids Res. 14: 6745, as disclosed in Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pages 353 to 358 (1979); (2) a 3.0 penalty for each interval and an additional 0.10 penalty for each symbol in each interval (or 10 interval open penalty, penalty for length of
    Petition 870190063824, of 07/08/2019, p. 18/55
    10/40 interval 0.5); and (3) no penalty for final breaks. Therefore, the term homology or identity, as used in this document, represents relevance between sequences.
    [028] Additionally, it is evident that a polynucleotide that can be translated, due to codon degeneration, into a polypeptide variant comprised of an amino acid sequence in which the 85 s amino acid from the N-terminus of the SEQ amino acid sequence ID NO: 2 is replaced with a different amino acid, or a polypeptide variant that has homology or identity to it can also be included. In addition, by hybridization under stringent conditions with a probe that can be prepared from a known gene sequence (for example, a sequence complementary to all or part of the nucleotide sequence), any polynucleotide sequence that encodes a synthase variant of adenyl succinate that includes an amino acid sequence, where the 85 s amino acid of the amino acid sequence of SEQ ID NO: 2 is replaced with an amino acid selected from the group consisting of serine, alanine, valine, leucine, methionine, isoleucine, threonine, asparagine, glutamine, cysteine, tyrosine, lysine, aspartic acid and glutamic acid, can be included without limitation.
    [029] Another aspect of the present disclosure relates to a polynucleotide encoding the adenyl succinate synthase variant, or a vector that includes the polynucleotide.
    [030] As used herein, the term "polynucleotide" refers to a DNA or RNA chain of more than a certain length as a nucleotide polymer, which is a long chain of nucleotide monomers linked by covalent bonds and, more specifically , to a polynucleotide fragment encoding the polypeptide variant.
    [031] The polynucleotide encoding the polypeptide variant of the present disclosure can include any polynucleotide sequence without limitation, as long as it encodes the polypeptide variant that has adenyl synthetase activity.
    Petition 870190063824, of 07/08/2019, p. 19/55
    11/40 succinate. In the present disclosure, the gene encoding the adenyl succinate synthase amino acid sequence is the purA gene, and specifically the gene can be derived from, but is not limited to, Corynebacterium stationis.
    [032] Specifically, due to codon degeneration or considering codons preferred by a microorganism in which the polypeptide is capable of being expressed, various modifications can be made to the polynucleotide coding region within the scope that does not alter the polypeptide's amino acid sequence. . Any polynucleotide sequence can be included without limitation as long as it encodes the adenyl succinate synthase variant, where the 85 s amino acid in the amino acid sequence of SEQ ID NO: 2 is replaced by a different amino acid.
    [033] Additionally, by hybridization under stringent conditions with a probe that can be prepared from a known genetic sequence (for example, a sequence complementary to all or part of the nucleotide sequence), any sequence that encodes a protein that has the activity of an adenyl succinate synthase variant, the 85 s amino acid in the amino acid sequence of SEQ ID NO: 2 is replaced with a different amino acid, can be included without limitation.
    [034] The "stringent conditions" refer to conditions that allow specific hybridization between polynucleotides. Such conditions are described in detail in the literature (for example, J. Sambrook et al., Supra). Strict conditions may include conditions under which genes that have high homology or identity (for example, genes with 40% or more, specifically 90% or more, more specifically 95% or more, even more specifically 97% or more, particularly specifically 99% or more of homology or identity) can hybridize to each other; conditions under which genes that have low homology or identity cannot hybridize to each other; or conditions that are common washing conditions for Southern hybridization (for example, a salt concentration and a temperature corresponding to 60 ° C, 0.1 x SSC, 0.1% SDS; specifically 60
    Petition 870190063824, of 07/08/2019, p. 20/55
    12/40 ° C, 0.1 x SSC, 0.1% SDS; more specifically 68 ° C, 0.1 x SSC, 0.1% SDS, once, specifically, two or three times).
    [035] Hybridization requires that two nucleic acids have complementary sequences, although divergences between bases may be possible depending on the severity of hybridization. The term complementary is used to describe the relationship between nucleotide bases that can hybridize to each other. For example, in relation to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the present disclosure can also include isolated nucleic acid fragments complementary to the entire sequence, as well as to substantially similar nucleic acid sequences.
    [036] Specifically, a polynucleotide that has homology or identity can be detected using hybridization conditions that include a 55 ° C Tm hybridization step and using the conditions described above. In addition, the Tm value can be 60 ° C, 63 ° C or 65 ° C, but is not limited to this, and can be appropriately controlled by those skilled in the art according to the purpose.
    [037] The appropriate severity for hybridization polynucleotides depends on the length of the polynucleotides and the degree of complementation and variables well known in the art (see Sambrook et al., Supra, 9.50 to 9.51,11.7 to 11, 8).
    [038] In the present disclosure, the gene encoding the amino acid sequence of the adenyl succinate synthase variant is the purA gene and the polynucleotide encoding the gene is the same as explained above.
    [039] In the present disclosure, the polynucleotide encoding the adenyl succinate synthase variant is also the same as explained above.
    [040] As used herein, the term vector refers to a DNA construct that contains the nucleotide sequence of the polynucleotide that encodes the target polypeptide that is operably linked to an appropriate control sequence so that the target polypeptide is expressed in an appropriate host. The control sequence can include a promoter to initiate the
    Petition 870190063824, of 07/08/2019, p. 21/55
    13/40 transcription, any operator sequence to control that transcription, a sequence that encodes an appropriate ribosome binding site in the mRNA and a sequence to control termination of transcription and translation. After transformation into an appropriate host, the vector can replicate or function independently of the host's genome, or it can integrate into the genome itself.
    [041] The vector used in the present disclosure may not be particularly limited as long as the vector is replicable in the host cell, and any vector known in the art can be used. Examples of the commonly used vector may include plasmids, cosmids, viruses and natural or recombinant bacteriophages. For example, as a phage vector or cosmid vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21 A, etc., can be used, and those based on plasmid in pBR, pUC, pBluescriptll, pGEM, pTZ, pCL, pET, etc. can be used. Specifically, pDZ, pACYC177, pACYCI 84, pCL, pECCG117, pUC19, pBR322, pMW118, vector pCC1 BAC, etc. can be used.
    [042] In one embodiment, the polynucleotide encoding the target polypeptide can be inserted into the chromosome through a vector for chromosomal insertion. The insertion of a polynucleotide in the chromosome can be carried out using any method known in the art (for example, by homologous recombination), but the method is not limited to the same. A checkmark to confirm insertion of the vector on the chromosome can also be included. The selection marker was used to select cells transformed with the vector (that is, to confirm the presence of the target nucleic acid molecule) and markers capable of providing selectable phenotypes (for example, drug resistance, auxotrophy, resistance to agents cytotoxic and surface polypeptide expression) can be used. In the circumstances in which selective agents are treated, only cells with the capacity to express selection markers can survive or express other phenotypic characteristics, and thus transformed cells can be easily selected.
    Petition 870190063824, of 07/08/2019, p. 22/55
    14/40 [043] Yet another aspect of the present disclosure provides a microorganism that produces purine nucleotides containing the adenyl succinate synthase variant or a polynucleotide encoding the adenyl succinate synthase variant. Specifically, the microorganism containing the adenyl succinate synthase variant and / or the polynucleotide encoding the adenyl succinate synthase variant may be a microorganism prepared by transformation using a vector containing the polynucleotide, but the microorganism is not limited at the same.
    [044] As used herein, the term transformation refers to a process of introducing a vector that includes a polynucleotide that encodes a target protein in a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. It does not matter whether the transformed polynucleotide is inserted into the chromosome of the host cell and located on the same or located outside the chromosome, as long as the transformed polynucleotide can be expressed in the host cell. In addition, the polynucleotide can include DNA and RNA that encodes the target protein. The polynucleotide can be introduced in any form, as long as the polynucleotide can be introduced into the host cell and expressed there. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a gene construct that includes all the elements necessary for its autonomous expression. The expression cassette can include a promoter, a transcription termination signal, a ribosome binding site and a translation termination signal that can be operably linked to the polynucleotide. The expression cassette can be in the form of an expression vector that performs self replication. In addition, the polynucleotide can be introduced into the host cell as it is operationally linked to, but not limited to, the sequence required for expression in the host cell.
    [045] Additionally, the term "operably linked" refers to a functional link between the gene sequence and a promoter sequence that initiates and mediates
    Petition 870190063824, of 07/08/2019, p. 23/55
    15/40 transcribing the polynucleotide encoding the target polypeptide of the present disclosure. [046] The term “microorganism that includes a variant of polypeptide” or “microorganism that includes a variant of adenyl succinate synthetase”, as used herein, refers to a microorganism with IMP productivity or XMP productivity in a microorganism, which naturally has poor IMP productivity or its parent strain without IMP productivity or XMP productivity. Specifically, the microorganism can be a microorganism that expresses a variant of adenyl succinate synthetase that includes at least one variation of amino acids in the amino acid sequence of SEQ ID NO: 2, and the amino acid modification may include the replacement of the 85 s amino acid of the End of the amino acid sequence of SEQ ID NO: 2 with a different amino acid. Additionally, the microorganism may be a microorganism that expresses a polypeptide variant that has the activity of adenyl succinate synthase, where the 85 s amino acid in the amino acid sequence of SEQ ID NO: 2 is replaced by a different amino acid, but the microorganism is not limited to the same.
    [047] The microorganism can be a cell or microorganism that contains a polynucleotide that encodes an adenyl succinate synthase variant, or a cell or microorganism that is transformed with a vector and is capable of expressing an adenyl succinate synthase variant. For the purpose of the present disclosure, the host cell or microorganism can be any microorganism that can express purine nucleotides containing the adenyl succinate synthase variant.
    [048] In the present disclosure, the term microorganism that produces purine nucleotides can be used interchangeably with a microorganism that produces purine nucleotides and a microorganism that has purine nucleotide productivity.
    [049] For the purpose of the present disclosure, the term "purine nucleotide" refers to a nucleotide that includes a purine-based structure, for example, IMP or XMP, but the purine nucleotide is not limited to it.
    Petition 870190063824, of 07/08/2019, p. 24/55
    16/40 [050] In the present disclosure, the term microorganism that produces purine nucleotides can be a microorganism in which a genetic modification has occurred or activity has been intensified for the production of desired purine nucleotides, which includes both a wild type microorganism as microorganisms in which a natural or artificial genetic modification has occurred and the microorganism may be a microorganism in which a particular mechanism is improved or weakened due to reasons such as the insertion of an exogenous gene, increase or inactivation of the activity of an exogenous gene, etc. For the purpose of the present disclosure, the microorganism that produces purine nucleotides is characterized in that it has an increased productivity of the desired purine nucleotides, containing the adenyl succinate synthase variant and, specifically, the microorganism may be a microorganism of the genus Corynebacterium. Specifically, the nucleotide-producing microorganism or purine microorganisms with purine nucleotide productivity may be a microorganism in which part of the gene involved in the purine nucleotide biosynthesis pathway is increased or weakened, or part of the gene involved in the nucleotide degradation pathway. purine is increased or weakened. For example, the microorganism may be a microorganism in which the expression of purF encoding phosphoribosylpyrophosphate amidotransferase is increased or the expression of guaB encoding 5'-inosine monophosphate dehydrogenase corresponding to the IMP degradation pathway , but the microorganism is not limited to the same.
    [051] As used herein, the term microorganism of the genus Corynebacterium that produces 5'-nucleotides of purine refers to a microorganism of the genus Corynebacterium that has purine nucleotide productivity naturally or by modification. Specifically, as used herein, the microorganism of the genus Corynebacterium that has purine nucleotide productivity may be a microorganism of the genus Corynebacterium that improved the productivity of purine nucleotides by increasing or weakening the activity of the purA gene that encodes synthetase
    Petition 870190063824, of 07/08/2019, p. 25/55
    17/40 adenyl succinate. More specifically, as used herein, the microorganism of the genus Corynebacterium with productivity of purine nucleotides may be a microorganism of the genus Corynebacterium that improved the productivity of purine nucleotides that include the variant of adenyl succinate synthase of the present disclosure or the polynucleotide that encodes the same, or because it is transformed with a vector that includes the polynucleotide that encodes the adenyl succinate synthase variant. The microorganism of the genus Corynebacterium that has an improved purine nucleotide productivity refers to a microorganism that has an improved purine nucleotide productivity, compared to its parent strain before transformation or a non-variant microorganism. The “non-variant micro-organism” refers to a wild-type strain, a micro-organism that does not include the variant protein that produces purine nucleotides, or a micro-organism that is not transformed with the vector that contains the polynucleotide that encodes the synthase variant of adenyl succinate.
    [052] As used in this document, the 'microorganism of the genus Corynebacteriurrí' can be specifically Corynebacterium glutamicum, Corynebacterium ammoniagenes, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium thermoaminogenes, Corynebacterium efficiens, etc. themselves. [053] Yet another aspect of the present disclosure provides a method of preparing purine nucleotides, which includes culturing the microorganism of the genus Corynebacterium which produces purine nucleotides in a medium and which retrieves the purine nucleotides from the microorganism or the medium.
    [054] In the above method, the culture of the microorganism can be carried out by a known batch culture, continuous culture, fed batch culture, etc., but the culture method is not particularly limited to them. In particular, the culture conditions may not be particularly limited, but an ideal pH (for example, pH 5 to pH 9, specifically pH 6 to pH 8, and more specifically pH 6.8) can be adjusted using a compound basic (for example, hydroxide
    Petition 870190063824, of 07/08/2019, p. 26/55
    18/40 sodium, potassium hydroxide or ammonia) or an acidic compound (eg, phosphoric acid or sulfuric acid), and an aerobic condition can be maintained by adding oxygen or oxygen-containing gas mixes to the culture. The culture temperature can be maintained between 20 ° C and 45 ° C, and specifically between 25 ° C and 40 ° C, and the culture can be carried out for about 10 hours to about 160 hours, but the conditions are not limited the same. The 5'-inosinic acid produced by the culture can be secreted into the medium or can remain inside the cells.
    [055] In addition, in the culture medium to be used, as a source of carbon, sugars and carbohydrates (eg glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose), oils and fats {eg soybean oil, sunflower seed oil, peanut oil and coconut oil), fatty acids (eg palmitic acid, stearic acid and linoleic acid), alcohols (eg glycerol and ethanol), organic acids (eg , acetic acid), etc. or in combination, but the carbon source is not limited to that. As a source of nitrogen, an organic compound containing nitrogen (eg, peptone, yeast extract, meat extract, malt extract, corn liquor, soy flour and urea) or an inorganic compound (eg ammonium sulfate , ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate), etc. they can be used alone or in combination, but the nitrogen source is not limited to them. As a source of phosphorus, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, a corresponding sodium-containing salt, etc. they can be used alone or in combination, but the source of phosphorus is not limited to them. In addition, the medium can also include materials that promote essential growth, such as other metal salts (e.g., magnesium sulfate or iron sulfate), amino acids and vitamins.
    [056] A method for recovering purine nucleotides produced in the cultivation step of the present disclosure is to collect the desired purine nucleotides from the culture using an appropriate method known in the art according to the culture method. For example, centrifugation, filtration,
    Petition 870190063824, of 07/08/2019, p. 27/55
    19/40 anion exchange chromatography, crystallization, HPLC, etc., and the desired purine nucleotides can be recovered from the medium or microorganism using an appropriate method known in the art.
    [057] Additionally, the recovery step may include a purification process. The purification process can be carried out using an appropriate method known in the art. Therefore, the recovered purine nucleotides can be in a purified form or in a microbial fermentation liquid that includes purine nucleotides (Introduction to Biotechnology and Genetic Engineering, A. J. Nair, 2008).
    [ADVANTAGE EFFECTS OF THE INVENTION] [058] When a microorganism of the genus Corynebacterium which produces purine nucleotides using the adenyl succinate synthase variant of the present disclosure, it is possible to produce purine nucleotides in high yield.
    [DETAILED DESCRIPTION OF THE INVENTION] [059] Hereinafter, the present disclosure is described in detail through exemplary modalities. However, it will be apparent to those skilled in the art to which the present disclosure belongs that these exemplary embodiments are provided for illustrative purposes only and are not intended to limit the scope of the present disclosure.
    Example 1: PREPARATION OF IMP PRODUCTION CEPA BASED ON THE WILD TYPE [060] The wild type strain of the genus Corynebacterium cannot produce IMP at all or can produce only a very small amount, even if it is possible. Consequently, an IMP production strain was prepared based on Corynebacterium stationis ATCC6872. More specifically, the IMP-producing strain was prepared by increasing the activity of the purF gene that encodes the phosphoryl phosphoryl phosphorus phosphate amidotransferase, which is the first enzyme in purine biosynthesis, and weakening the activity of the guaB gene that encodes dehydrogenase
    Petition 870190063824, of 07/08/2019, p. 28/55
    20/40 of 5'-inosinic acid which corresponds to the IMP degradation pathway.
    EXAMPLE 1-1: IMPROVED CEPH PREPARATION WITH PURF [061] To prepare a strain in which the initial codon of the modified purFé gene, an insertion vector containing the purF gene of SEQ ID NO: 3 was prepared. To specifically clone the purF gene into an insertion vector, PCR was performed using the genomic DNA of Corynebacterium stationis ATCC6872 as a model and the primers of SEQ ID NOS: 4 and 5 and SEQ ID NOS: 6 and 7 during 30 cycles of denaturation at 94 ° C for 30 s, annealing at 55 ° C for 30 s and extension at 72 ° C for 2 min. PCR was performed again using two DNA fragments obtained by the PCR above as a model and primers of SEQ ID NOS: 4 and 72 during 30 cycles of denaturation at 94 ° C for 30 s, annealing at 55 ° C for 30 s and extension to 72 ° C for 2 min to obtain DNA fragments. The obtained DNA fragments were digested with a restriction enzyme Xba and cloned into the vector pDZ (Patent number KR 10-0924065 and International Publication number 2008-033001) digested with the same enzyme. The vector thus prepared was called pDZ-purF-g1a.
    [1 FABELA 1] SEQ IDAT THE Initiator String (5’-3 ’) 4 purF g1a-1 GCTCTAGACCACTCTAAGACGCGGCCACC 5 purF g1a-2 AAGTAGTGTTCACCATGACGCTGATTCTACTAAGTTT 6 purF g1a-3 AGTAGAATCAGCGTCATGGTGAACACTACTTTCCCCAG 7 purF g1a-4 GCTCTAGACTGTGCGCCCACGATATCCAG
    Petition 870190063824, of 07/08/2019, p. 29/55
    21/40 [062] The recombinant vector pDZ-purF-g1 a was transformed into Corynebacterium stationis ATCC6872 by electroporation, and strains in which the vector was inserted into genomic DNA by homologous recombination were selected in medium containing 25 mg / l kanamycin . The selected primary strains were subjected to secondary intersection, and these selected strains were subjected to sequencing, and thus the desired strain into which the mutation was introduced was selected. The strain was named as ATCC6872 :: purF (g1 a) strain.
    EXAMPLE 1-2: PREPARATION OF GUAB WEAKENED CEPA [063] To prepare a strain in which the initial codon of the guaB gene is modified, an insertion vector containing the guaB gene of SEQ ID NO: 8 was prepared. To clone the guaB gene in the insertion vector, specifically, PCR was performed using the genomic DNA of Corynebacterium stationis ATCC6872 as a model and primers for SEQ ID NOS: 9 and 10 and SEQ ID NOS: 11 and 12. PCR products were cloned as in Example 1 -1 and the prepared vector was called pDZguaB-a1t. The vector was introduced into ATCC6872 :: purF (g1a) and the strain into which the above mutation was introduced was finally selected.
    [064] The strain based on Corynebacterium stationis ATCC6872 of the wild type finally selected that produces the IMP and was named CJI2330.
    [TABLE 2]
    SEQ ID NO Initiator String (5’-3 ’) 9 guaB a11-1 GCTCTAGACTACGACAACACGGTGCCTAA 10 guaB a1t-2 CACGATTTTCGGTCAATACGGGTCTTCTCCTTCGCA C 11 guaB a1t-3 AGGAGAAGACCCGTATTGACCGAAAATCGTGTTTC T 12 guaB a1t-4 GCTCTAGAATCGACAAGCAAGCCTGCACG
    EXAMPLE 1-3: CJI2330 FERMENTATION TITRATION TEST
    Petition 870190063824, of 07/08/2019, p. 30/55
    22/40 [065] After dispensing a seed culture medium (2 ml) in test tubes (diameter: 18 mm), the tubes were self-claved. Each of ATCC6872 and CJI2330 was inoculated and incubated at 30 ° C for 24 h with shaking and used as a seed culture. A fermentation medium (29 ml) was dispensed into each 250 ml Erlenmeyer flask, and autoclaved at 121 ° C for 15 min. The seed culture (2 ml) was inoculated into the medium and grown for 3 days. The culture conditions were adjusted to 170 rpm, 30 ° C and pH 7.5.
    [066] Upon completion of the culture, the amount of IMP production was measured by HPLC (SHIMAZDU LC20A), and the culture results are as in Table 3 below. The following results suggest that the strain improved by purF and weakened by purA has IMP productivity.
    [TABLE 3]
    Strain IMP (g / l) ATCC6872 0 CJI2330 0.50
    [067] - Seed culture medium: 1% glucose, 1% peptone, 1% meat extract, 1% yeast extract, 0.25% sodium chloride, 100 mg / l adenine, 100 mg / l guanine, pH 7.5 [068] - Fermentation medium: 0.1% sodium glutamate, ammonium chloride
    1%, 1.2% magnesium sulfate, 0.01% calcium chloride, 20 mg / l manganese sulphate, 20 mg / l manganese sulphate, 5 mg / l zinc sulphate, 23 mg / l L-cysteine, 24 mg / l alanine, 8 mg / l nicotinic acid, 45 pg / l biotin, 5 mg / l thiamine hydrochloride, 30 mg / l adenine, 1.9% acid phosphoric (85%), 2.55% glucose 1.45% fructose
    EXAMPLE 2: PREPARATION OF WEAKENED ADENYL SUCCINATE SYNTHETASE VARIANT [069] To discover a variant of adenyl succinate synthase with
    Petition 870190063824, of 07/08/2019, p. 31/55
    In order to improve the productivity of purine nucleotides, a mutant purA gene library encoding adenyl succinate synthase was prepared.
    EXAMPLE 2-1: PREPARATION OF VECTOR CONTAINING PURE GENE [070] To prepare a mutant library for the purA gene, a recombinant vector containing the purA gene was first prepared. PCR was performed using the genomic DNA of Corynebacterium stationis ATCC6872 as a model and the primers of SEQ ID NO: 13 and SEQ ID NO: 14, and the PCR product was cloned into the E. coli pCR2.1 vector using a TOPO cloning kit (Invitrogen) to obtain pCR-guaB.
    [TABLE 4]
    SEQ ID NO Initiator String (5’-3 ’) 13 purA 5 'primer F (temp) ATGGCTAAATACATTATCACT 14 purA 3 'primer R(temp) TGTGCTGGAGACCCCTCATAG
    EXAMPLE 2-2: PREPARATION OF PURE GENE MUTANT LIBRARY [071] A mutant library of the purA gene was prepared based on the vector prepared in Example 2-1. The library was prepared using an error-prone PCR kit (Clontech Diversify® PCR Random Mutagenesis Kit). Under conditions where mutations can occur, PCR was performed using primers of SEQ ID NO: 15 and SEQ ID NO: 16. Specifically, under conditions where 0 to 3 mutations per 1,000 bp can occur, preheating was performed at 94 ° C for 30 s, followed by 25 cycles of 94 ° C for 30 s and 68 ° C for 1 min 30 s. A PCR product thus obtained was subjected to PCR using a mega primer (500 ng to 125 ng) for 25 cycles of 95 for 50 s, 60 for 50 s and 68 for 12 min, treated with Dpn and transformed into E. coli DH5a and spread on a solid LB medium containing kanamycin (25 mg / l). After selecting 20 different types of transformed colonies, plasmids were obtained from them and subjected to
    Petition 870190063824, of 07/08/2019, p. 32/55
    24/40 sequencing. As a result, it was confirmed that the mutations were introduced at different sites with a frequency of 2 mutations / kb. About 20,000 transformed E. coli colonies were collected and the plasmids were extracted and named as a pTOPO-purA library.
    [TABLE 5]
    SEQ ID NO Initiator String (5’-3 ’) 15 purA PCR error initiator F AAGGGCAAAGCTACAGACATC 16 purA PCR error initiator R CCGCCGAGCATGAGAACCCGA
    EXAMPLE 3: EVALUATION OF PREPARED LIBRARY AND CEPA SELECTION
    EXAMPLE 3-1: LIBRARY EVALUATION [072] The pTOPO-purA library prepared in Example 2-2 was transformed into the CJI2330 strain prepared in Example 1 by electroporation, and the strain was spread on a nutrient medium containing 25 mg / l of kanamycin to obtain 10,000 colonies into which the mutant gene has been inserted. Each of the colonies was named as CJI2330 :: pTOPO_purA (mt) 1 to CJI2330 :: pTOPO_purA (mt) 10,000.
    [073] - Nutrient medium: 1% peptone, 1% meat extract, 0.25% sodium chloride, 1% yeast extract, 2% agar, pH 7.2 [074] Each of 10,000 colonies obtained were inoculated into 200 pl of an autoclaved seed culture medium and cultured in a 96-well deep well with shaking at 30 ° C, 1,200 rpm for 24 hours using a microplate shaker (TAITEC) and used as a seed culture. The autoclaved fermentation medium (290 μΙ) was dispensed in a 96-well deep plate and 20 μΙ of each of the seed cultures were inoculated into it, followed by culture with agitation under the same conditions as above for 72 hours.
    [075] To analyze the 5'-inosinic acid produced in the culture medium, after the end of the culture, 3 μΙ of the culture supernatant was transferred to a plate
    Petition 870190063824, of 07/08/2019, p. 33/55
    25/40
    96-well UV, in which each well contained 197 pl of distilled water and stirred for 30 seconds using a microplate reader and absorbance was measured at 270 nm at 25 ° C using a spectrophotometer. The absorbance was compared with that of the CJI2330 strain, and 50 colonies of mutant strains showing an increase of 10% or more in the absorbance were selected. Other colonies showed similar or decreased absorbance compared to the control.
    [076] The absorbance of the 50 selected strains was measured in the same way as above to repeatedly examine the amount of 5'inosinic acid production. One strain, CJI2330 :: pTOPO_purA (mt) 333, which showed a significant improvement in the productivity of 5'-inosinic acid compared to the CJI2330 strain, was selected.
    [077] To confirm the validity of selected mutants, a fermentation titration test was performed.
    [078] After dispensing a seed culture medium (2 ml) in test tubes (diameter: 18 mm), the tubes were self-claved. Each of CJI2330 and CJI2330 :: pTOPO_purA (mt) 333 was inoculated and incubated at 30 ° C for 24 h with shaking and used as a seed culture. A fermentation medium (29 ml) was dispensed into each 250 ml Erlenmeyer flask, and autoclaved at 121 ° C for 15 min. The seed culture (2 ml) was inoculated into the medium and grown for 3 days. The culture conditions were adjusted to 170 rpm, 30 ° C and pH 7.5.
    [079] Upon completion of the culture, the amount of IMP production was measured by HPLC (SHIMAZDU LC20A), and the culture results are as in Table 6 below.
    [TABLE 6]
    Strain IMP (g / l) CJI2330 0.50 CJI2330 :: pTOPO purA (mt) 333 0.61
    Petition 870190063824, of 07/08/2019, p. 34/55
    26/40 [080] As can be seen from the results above, it was confirmed that the amount of IMP was increased by about 122% in the strain in which a vector containing a mutation of the purA gene compared to the CJI2330 strain. Consequently, it was determined that the mutation selected in the library was valid.
    EXAMPLE 3-2: CONFIRMATION OF PURE VARIATION [081] To confirm the gene variation of the mutant strain, PCR was performed on strain CJI2330 :: pTOPO_purA (mt) 333 using primers from SEQ ID NOS: 17 and 18, and the PCR product was subjected to sequencing, thus confirming the presence of variation in the purA gene.
    [TAB SHE 7] SEQ ID NO Initiator String (5’-3 ’) 17 pure seq F GACGCGTCGGAATCGCCGATA 18 pure seq R CCGCCGAGCATGAGAACCCGA
    [082] Specifically, it has been confirmed that the purA gene of the CJI2330 :: pTQPQ_purA (mt) 333 strain includes a variation in which the 85 s amino acid (ie glycine) of the purA amino acid sequence represented by SEQ ID NO: 2 is replaced by serine (i.e., the 253 s nucleotide, g, is replaced by a nucleotide a). Consequently, in the Examples hereinafter, attempts have been made to confirm whether the above variation can affect the amount of purine nucleotide production in each microorganism of the genus Corynebacterium.
    EXAMPLE 4: CONFIRMATION OF IMP PRODUCTION IN ATCC6872 DERIVED IMP PRODUCTION CEPA [083] An ATCC6872 derived IMP producing strain was prepared, and the variation confirmed in Example 3 was introduced into the strain and the strain's IMP yield was confirmed .
    EXAMPLE 4-1: IMP PRODUCTION CEPA SELECTION
    Petition 870190063824, of 07/08/2019, p. 35/55
    27/40
    ATCC6872 DERIVED [084] To prepare an IMP producing strain derived from the ATCC6872 strain, the ATCC6872 culture was suspended in a phosphate buffer (pH 7.0) or citrate buffer (pH 5.5) at a density of 10 7 cells / ml to 10 8 cells / ml and treated with UV at room temperature or 32 ° C for 20 min to 40 min to induce a mutation. The strain was washed with 0.85% saline twice and spread, after dilution, in a minimum medium containing 1.7% agar that was supplemented with a material that provides resistance to an appropriate concentration, and so were colonies were obtained. Each colony was grown in nutrient medium and then grown in seed culture medium for 24 hours. After the culture of each colony in fermentation medium for 3 to 4 days, colonies were selected that showed excellent production of IMP accumulated in the culture medium. To prepare a strain that produces IMP in high concentration, adenine-auxotrophic, of the guanine-leaking type, lysozyme sensitivity, 3,4-dehydroproline resistance, streptomycin resistance, sulfaguanidine resistance, norvaline resistance and resistance to trimethoprim were provided by performing the corresponding procedures sequentially. As a result, the CJI2335 strain endowed with resistance to the above materials and which has excellent IMP productivity was finally selected. The resistance of the CJI2332 strain to that of ATCC6872 was compared and the results are shown in Table 8 below.
    [TABLE 8]
    Feature ATCC6872 CJI2332 Adenine-auxotroph Non-auxotrophic Auxotrofo Leaky typeguanine Non-auxotrophic Leaking type Lysozyme sensitivity 80 pg / ml 8 pg / ml 3,4-resistance tohydroproline 1,000 pg / ml 3,500 pg / ml
    Petition 870190063824, of 07/08/2019, p. 36/55
    28/40
    Streptomycin resistance 500 pg / ml 2,000 pg / ml Sulfaguanidine resistance 50 pg / ml 200 pg / ml Norvaline resistance 0.2 mg / ml 2 mg / ml Trimethoprim resistance 20 pg / ml 100 pg / ml
    [085] - Minimum medium: 2% glucose, 0.3% sodium sulfate, 0.1% monopotassium phosphate, 0.3% dipotassium phosphate, 0.3% magnesium sulfate, 10 mg / l calcium chloride, 10 mg / l iron sulfate, 1 mg / l zinc sulfate, 3.6 mg / l manganese chloride, 20 mg / l L-cysteine, 10 mg / l calcium pantothenate , 5 mg / l thiamine hydrochloride, 30 pg / l biotin, 20 mg / l adenine, 20 mg / l guanine, adjusted to pH 7.3.
    EXAMPLE 4-2: CJI2332 FERMENTATION TITRATION TEST [086] After dispensing a seed culture medium (2 ml) in test tubes (diameter: 18 mm), the tubes were self-claved. Each of ATCC6872 and CJI2332 was inoculated and incubated at 30 ° C for 24 hours with agitation and used as a seed culture. A fermentation medium (29 ml) was dispensed into each 250 ml Erlenmeyer flask, and autoclaved at 121 ° C for 15 min. The seed culture (2 ml) was inoculated into the medium and grown for 3 days. The culture conditions were adjusted to 170 rpm, 30 ° C and pH 7.5.
    [087] Upon completion of the culture, the amount of IMP production was measured by HPLC (SHIMAZDU LC20A), and the culture results are as in Table 9 below.
    [TABLE 9]
    Strain IMP (g / l) ATCC6872 0 CJI2332 1.74
    Petition 870190063824, of 07/08/2019, p. 37/55
    29/40
    EXAMPLE 4-3: INSERT VECTOR PREPARATION CONTAINING PURE VARIATION [088] To introduce the variations selected in Example 3 into the strains, an insertion vector was prepared. The process of preparing the vector for introducing the purA variation (G85S) is as follows. PCR was performed using CJI2330 :: Topo_purA (G85S) as a model and the primers of SEQ ID NO: 19 and SEQ ID NO: 20. PCR was performed as follows: denaturation at 94 ° C for 5 min; 20 cycles of denaturation at 94 ° C for 30 seconds, annealing at 55 ° C for 30 s and polymerization at 72 ° C for 1 min; and polymerization at 72 ° C for 5 min. The gene fragments thus obtained were digested with Xba . Each gene fragment was cloned into a linear pDZ vector digested with Xba using T4 ligase and, thus, the vector pDZ-purA (G85S) was prepared.
    [TABLE 10]
    SEQ ID NO Initiator String (5’-3 ’) 19 purA (G85S) F ’ GCTCTAGATGCCGGCATTTTTCGAAGC 20 purA (G85S) R GCTCTAGAAAGTAGTCGGTAAAGCCGTTG
    EXAMPLE 4-4: INTRODUCTION OF VARIANT INTO CJI2330 AND CJI2332 ATCC6872-DERIVED STRUCTURES AND THEIR EVALUATION [089] The purA variation was introduced in each of the CJI2330 strains producing wild-type IMP prepared in Example 1 and in the selected CJI2332 strain in Example 4-1, and the amount of IMP produced by each strain was evaluated. To confirm the presence of a variation in the purA gene, the chromosomal DNA of the strain CJI2332 was amplified by PCR. Specifically, first, the purA gene fragments were amplified by PCR using the chromosomal DNA of the strain CJI2332 as a model and the SEQ ID NOS primers: 17 and 18, in which the PCR was performed for 28 cycles of denaturation at 94 ° C for 1 min; annealing at 58 ° C for 30 s and polymerization at 72 ° C for 2 min with use
    Petition 870190063824, of 07/08/2019, p. 38/55
    30/40 Taq DNA polymerase. The nucleotide sequences of the amplified purA fragments were analyzed using the same primers and, as a result, it was confirmed that there was no variation in the purA gene of the CJI2332 strain.
    [090] Then, the vector pDZ-purA (G85S) was transformed into strain CJ12330 and strain CJI2332, and the strains in which the vector was inserted into genomic DNA by recombination of homologous sequences were selected in medium containing kanamycin (25 mg / l). The selected primary strains were subjected to secondary intersection, and thus strains into which a variation of the target gene was introduced were selected. To confirm the introduction of the gene variation in the desired transformed strains, PCR was performed using primers from SEQ ID NO: 17 and SEQ ID NO: 18 and the PCR products were confirmed by sequence analysis. As a result, it was confirmed that genetic variation was introduced in the strains. The strains thus prepared were named CJI2330 :: purA (G85S) and CJI2332 :: purA (G85S), respectively.
    [091] IMP productivity for each of the strains CJI2330, CJI2332, CJI2330 :: purA (G85S) and CJI2332 :: purA (G85S) was evaluated. Upon completion of the culture, the amount of IMP production for each strain was measured by a method using HPLC, and the results of the culture are shown in Table 11 below.
    [TABLE 11]
    Strain IMP (g / l) CJI2330 0.50 CJI2330 :: purA (G85S) 0.61 CJI2332 1.74 CJI2332 :: purA (G85S) 2.03
    [092] In the above results, it was confirmed that the strain into which the purA gene variation was introduced showed an increase in the amount of IMP production by about 122% and about 116% compared to the CJI2330 and
    Petition 870190063824, of 07/08/2019, p. 39/55
    31/40
    CJI2332 producing wild-type IMP, respectively.
    [093] The CJI2332 strain was deposited with the Korean Culture Center of Microorganisms (KCCM) on 22 June 2018, under the provisions of the Budapest Treaty and received accession number KCCM12277P. In addition, the prepared CJI2332 :: purA (G85S) strain, also called CJI2348, was deposited with the KCCM on 22 June 2018, under the provisions of the Budapest Treaty and assigned the accession number KCCM12280P.
    Example 5: CONFIRMATION OF PRODUCTIVITY OF 5'XANTHYLIC ACID BY VARIABLE GENE PURA
    EXAMPLE 5-1: SELECTION OF ATCC6872-DERIVED XMP PRODUCTION STRIPS [094] To prepare a strain that produces 5'-xanthosin monophosphate (XMP) derived from ATCC6872, the ATCC6872 strain Corynebacterium stationis was suspended in phosphate buffer ( pH 7.0) or citrate buffer (pH 5.5) at a density of 10 7 cells / ml to 10 8 cells / ml and treated with UV at room temperature or 32 ° C for 20 min to 40 min to induce a mutation. The strain was washed with 0.85% saline twice and spread, after dilution, in a minimum medium containing 1.7% agar that was supplemented with a material that provides resistance to an appropriate concentration, and so were colonies were obtained. Each colony was grown in nutrient medium and then grown in seed culture medium for 24 h. After each colony was cultured in a fermentation medium for 3 to 4 days, colonies were selected that showed excellent XMP production accumulated in the culture medium. Specifically, strains were selected from those that can grow in a medium where fluorotryptophan is added according to concentrations (addition medium), and more specifically, from those that can grow in a medium with a fluorotriptophan concentration of 100 mg / l and improved concentration of 5'-xanthylic acid. The selected strain was named CJX1664.
    [095] - Minimum medium: glucose 20 g / l monopotassium phosphate 1 g / l phosphate
    Petition 870190063824, of 07/08/2019, p. 40/55
    32/40 dipotassium 1 g / l urea 2 g / l ammonium sulfate 3 g / l magnesium sulfate 1 g / l calcium chloride 100 mg / l iron sulfate 20 mg / l, manganese sulphate 10 mg / l, zinc sulfate 10 mg / l, biotin 30 pg / l, thiamine hydrochloride 0.1 mg / l, copper sulfate 0.8 mg / l, adenine 20 mg / l, guanine 20 mg / l, pH 7.2 [096] - Addition medium: a medium in which fluorotryptophan at a concentration of mg / l, 20 mg / l, 50 mg / l, 70 mg / l, 100 mg / l and 200 mg / l is added to a minimum medium [097] The biochemical characteristics of the CJX1664 strain are shown in Table 12 below. With reference to Table 12, the CJX1664 strain can be grown in an addition medium in which a fluorotryptophan is added at a concentration of 100 mg / l.
    [TABLE 12]
    Characteristics ATCC6872 CJX1664 Fluorotriptophan resistance 10 mg / l 100 mg / l
    EXAMPLE 5-2: CJX1664 FERMENTATION TITRATION TEST [098] After dispensing a seed culture medium (2 ml) in test tubes (diameter: 18 mm), the tubes were self-claved. Each of ATCC6872 and CJX1664 was inoculated and incubated at 30 ° C for 24 h with shaking and used as a seed culture. A fermentation medium (29 ml) was dispensed into each 250 ml Erlenmeyer flask, and autoclaved at 121 ° C for 15 min. The seed culture (2 ml) was inoculated into the medium and grown for 3 days. The culture conditions were adjusted to 170 rpm, 30 ° C and pH 7.5.
    [099] Upon completion of the culture, the amount of XMP production was measured by HPLC (SHIMADZU LC20A), and the culture results are as in Table 13 below.
    [TABLE 13]
    Strain XMP (g / l)
    Petition 870190063824, of 07/08/2019, p. 41/55
    33/40
    ATCC6872 0 CJX1664 4.72
    EXAMPLE 5-3: INTRODUCTION OF VARIANT IN CEPA CJX1664 AND ITS EVALUATION [0100] To confirm the presence of a variation of the purA gene of strain CJX1664 selected in Example 5-1, the chromosomal DNA PCR of strain CJX1664 was amplified by PCR. Specifically, first, the purA fragments were amplified by PCR using the chromosomal DNA of the strain CJX1664 as a model and the primers of SEQ ID NOS: 17 and 18, in which the PCR was performed for 28 cycles of denaturation at 94 ° C for 1 min; annealing at 58 ° C for 30 s and polymerization at 72 ° C for 2 min using Taq DNA polymerase. The nucleotide sequences of the amplified purA gene fragments were analyzed using the same primers and, as a result, it was confirmed that there was no variation in the purA gene of the CJX1664 strain.
    [0101] The vector prepared in Example 4-3 was transformed into strain CJX1664, and the strains in which the vector was inserted into genomic DNA by recombination of homologous sequences were selected in a medium containing 25 mg / l kanamycin. The selected primary strains were subjected to secondary intersection, and thus strains into which a variation of the target gene was introduced were selected. The introduction of gene variation in the desired transformed strains was confirmed by sequence analysis.
    [0102] The XMP productivity for each of the strains CJX1664 and CJX1664 :: purA (G85S) was evaluated. Upon completion of the culture, the amount of XMP production for each strain was measured by a method using HPLC, and the results of the culture are shown in Table 14 below.
    [TABLE 14]
    Strain XMP (g / l)
    Petition 870190063824, of 07/08/2019, p. 42/55
    34/40
    CJX1664 4.72 CJX1664 :: purA (G85S) 5.19
    [0103] As can be seen in table 14 above, the CJX1664 :: purA (G85S) strain showed an increase in the amount of XMP production by about 109% compared to the CJX1664 strain (that is, an XMP producing strain based on ATCC6872).
    [0104] The strain CJX1664 was deposited with the Korean Culture Center of Microorganisms (KCCM) on Friday, July 6, 2018, under the provisions of the Budapest Treaty and received accession number KCCM12285P. Additionally, the prepared CJX1664 :: purA (G85S) strain, also called CJX1665, was deposited with KCCM on Friday, July 6, 2018, under the provisions of the Budapest Treaty and assigned the accession number KCCM12286P.
    EXAMPLE 6: REPLACEMENT OF AMINO ACID IN VARIATION OF PURE BY DIFFERENT AMINO ACID
    EXAMPLE 6-1: VECTOR PREPARATION FOR AMINO ACID INSERT IN PURE VARIATION [0105] Through the Examples above, it was confirmed that the purA (G85S) variation can improve the productivity of purine nucleotides. In this sense, to confirm the positional importance of the purA variation, the effect of replacing the 85th amino acid with a different amino acid on the productivity of the purine nucleotides was examined. The process of preparing the vector for inserting the purA variation (G85S) is as follows. Site-directed mutagenesis was performed using the pDZ-purA (G85S) vector prepared in Example 4 as a skeleton. Specifically, PCR was performed using the sequences shown in Table 15 as primers under the following conditions: 18 cycles of denaturation at 94 ° C for 30 s, annealing at 55 ° C for 30 seconds and extension at 68 ° C for 12 min. The resulting PCR products were digested with Dpn , transformed into a DH5a strain, and colonies were obtained from it. The
    Petition 870190063824, of 07/08/2019, p. 43/55
    35/40 plasmids from the colonies thus obtained were obtained by a known plasmid extraction method and the information on the obtained plasmids is shown below in Table 15.
    [TABLE 15]
    SEQIDAT THE Initiator String (5’-3 ’) 21 purA (G85A) F CTTTGAGGAAATTGAAGCTCTCGAAGCCCGCGGCGC 22 purA (G85A) R GCGCCGCGGGCTTCGAGAGCTTCAATTTCCTCAAAG 23 purA (G85V) F CTTTGAGGAAATTGAAGTCCTCGAAGCCCGCGGCGC 24 purA (G85V) R GCGCCGCGGGCTTCGAGGACTTCAATTTCCTCAAAG 25 purA (G85L) F CTTTGAGGAAATTGAACTGCTCGAAGCCCGCGGCGC 26 purA (G85L) R GCGCCGCGGGCTTCGAGCAGTTCAATTTCCTCAAAG 27 purA (G85M) F CTTTGAGGAAATTGAAATGCTCGAAGCCCGCGGCGC 28 purA (G85M) R GCGCCGCGGGCTTCGAGCATTTCAATTTCCTCAAAG 29 purA (G85l) F CTTTGAGGAAATTGAAATCCTCGAAGCCCGCGGCGC 30 purA (G85l) R GCGCCGCGGGCTTCGAGGATTTCAATTTCCTCAAAG 31 purA (G85T) F CTTTGAGGAAATTGAAACTCTCGAAGCCCGCGGCGC 32 purA (G85T) R GCGCCGCGGGCTTCGAGAGTTTCAATTTCCTCAAAG 33 purA (G85N) F CTTTGAGGAAATTGAAAACCTCGAAGCCCGCGGCGC 34 purA (G85N) R GCGCCGCGGGCTTCGAGGTTTTCAATTTCCTCAAAG 35 purA (G85Q) F CTTTGAGGAAATTGAACAGCTCGAAGCCCGCGGCGC 36 purA (G85Q) R GCGCCGCGGGCTTCGAGCTGTTCAATTTCCTCAAAG 37 purA (G85C) F CTTTGAGGAAATTGAATGCCTCGAAGCCCGCGGCGC
    Petition 870190063824, of 07/08/2019, p. 44/55
    36/40
    38 purA (G85C) R GCGCCGCGGGCTTCGAGGCATTCAATTTCCTCAAAG 39 purA (G85P) F CTTTGAGGAAATTGAACCACTCGAAGCCCGCGGCGC 40 purA (G85P) R GCGCCGCGGGCTTCGAGTGGTTCAATTTCCTCAAAG 41 purA (G85Y) F CTTTGAGGAAATTGAATACCTCGAAGCCCGCGGCGC 42 purA (G85Y) R GCGCCGCGGGCTTCGAGGTATTCAATTTCCTCAAAG 43 purA (G85W) F CTTTGAGGAAATTGAATGGCTCGAAGCCCGCGGCGC 44 purA (G85W) R GCGCCGCGGGCTTCGAGCCATTCAATTTCCTCAAAG 45 purA (G85K) F CTTTGAGGAAATTGAAAAGCTCGAAGCCCGCGGCGC 46 purA (G85K) R GCGCCGCGGGCTTCGAGCTTTTCAATTTCCTCAAAG 47 purA (G85R) F CTTTGAGGAAATTGAACGCCTCGAAGCCCGCGGCGC 48 purA (G85R) R GCGCCGCGGGCTTCGAGGCGTTCAATTTCCTCAAAG 49 purA (G85H) F CTTTGAGGAAATTGAACACCTCGAAGCCCGCGGCGC 50 purA (G85H) R GCGCCGCGGGCTTCGAGGTGTTCAATTTCCTCAAAG 51 purA (G85D) F CTTTGAGGAAATTGAAGATCTCGAAGCCCGCGGCGC 52 purA (G85D) R GCGCCGCGGGCTTCGAGATCTTCAATTTCCTCAAAG 53 purA (G85E) F CTTTGAGGAAATTGAAGAACTCGAAGCCCGCGGCGC 54 purA (G85E) R GCGCCGCGGGCTTCGAGTTCTTCAATTTCCTCAAAG
    [TABLE 16]
    Number Plasmid 1 pDZ-purA G85A 2 pDZ-purA G85V 3 pDZ-purA G85L 4 pDZ-purA G85M
    Petition 870190063824, of 07/08/2019, p. 45/55
    37/40
    5 pDZ-purA G85I 6 pDZ-purA G85T 7 pDZ-purA G85N 8 pDZ-purA G85Q 9 pDZ-purA G85C 10 pDZ-purA G85P 11 pDZ-purA G85Y 12 pDZ-purA G85W 13 pDZ-purA G85K 14 pDZ-purA G85R 15 pDZ-purA G85H 16 pDZ-purA G85D 17 pDZ-purA G85E
    EXAMPLE 6-2: PREPARATION OF CEPA IN WHICH AN AMINO ACID IS REPLACED BY A DIFFERENT AMINO ACID ACCORDING TO THE VARIATION POSITION OF A PURE VARIANT, AND COMPARISON BETWEEN 5'-INOSINIC ACID PRODUCTIVITIES [0106] Each among 18 types of vectors, for the introduction of variants, prepared in Example 6-1 were transformed into strain CJI2332, and the strains in which these vectors were inserted into genomic DNA by homologous recombination were selected in a medium containing 25 mg / l kanamycin. The selected primary strains were subjected to secondary intersection and, thus, strains into which a variation of the target gene was introduced were selected. To confirm the introduction of the gene variation in the desired transformed strains, PCR was performed using primers from SEQ ID NO: 17 and SEQ ID NO: 18 and the products
    Petition 870190063824, of 07/08/2019, p. 46/55
    38/40
    PCR were confirmed by sequence analysis. The strains were named according to the variations entered, as shown in Table 17.
    [TABLE 17]
    Number Strain 1 CJI2332 :: purA (G85A) 2 CJI2332 :: purA (G85V) 3 CJI2332 :: purA (G85L) 4 CJI2332 :: purA (G85M) 5 CJI2332 :: purA (G85l) 6 CJI2332 :: purA (G85T) 7 CJI2332 :: purA (G85N) 8 CJI2332 :: purA (G85Q) 9 CJI2332 :: purA (G85C) 10 CJI2332 :: purA (G85P) 11 CJI2332 :: purA (G85Y) 12 CJI2332 :: purA (G85W) 13 CJI2332 :: purA (G85K) 14 CJI2332 :: purA (G85R) 15 CJI2332 :: purA (G85H) 16 CJI2332 :: purA (G85D) 17 CJI2332 :: purA (G85E)
    [0107] The concentration of 5'-inosinic acid was analyzed by cultivating the strains in the same manner as in Example 1.
    [TABLE 18]
    Petition 870190063824, of 07/08/2019, p. 47/55
    39/40
    Concentration of 5'-inosinic acid with variation in purA (g / l) Number Strain Average 5'-inosinic acidCJI2332 1.74 Control group CJI2332 :: purA (G85S) 2.03 1 CJI2332 :: purA (G85A) 1.93 2 CJI2332 :: purA (G85V) 1.84 3 CJI2332 :: purA (G85L) 2.01 4 CJI2332 :: purA (G85M) 2.01 5 CJI2332 :: purA (G85l) 2.02 6 CJI2332 :: purA (G85T) 2.02 7 CJI2332 :: purA (G85N) 1.83 8 CJI2332 :: purA (G85Q) 2.03 9 CJI2332 :: purA (G85C) 1.82 10 CJI2332 :: purA (G85P) 1.10 11 CJI2332 :: purA (G85Y) 1.92 12 CJI2332 :: purA (G85W) 0.39 13 CJI2332 :: purA (G85K) 1.86 14 CJI2332 :: purA (G85R) 1.30 15 CJI2332 :: purA (G85H) 1.67 16 CJI2332 :: purA (G85D) 2.02 17 CJI2332 :: purA (G85E) 1.94
    Petition 870190063824, of 07/08/2019, p. 48/55
    40/40 [0108] With reference to Table 18 above, it was confirmed that strains containing purA, in which the 85th amino acid of the amino acid sequence encoding the purA gene is replaced by a different amino acid, a significant change was shown in the amount of IMP production, compared to other strains that did not contain the above variation. That is, it was confirmed that the 85th amino acid of the amino acid sequence that encodes the purA gene is an important position for the variation associated with the production of purine nucleotides, and when the 85th amino acid of the amino acid sequence that encodes the purA gene is replaced by an amino acid selected from the group consisting of serine, alanine, valine, leucine, methionine, isoleucine, threonine, asparagine, glutamine, cysteine, tyrosine, lysine, aspartic acid and glutamic acid, the microorganism that has the variation can increase significantly the production of purine nucleotides.
    [0109] From what was mentioned earlier, a person skilled in the technique to which the present disclosure refers will have the ability to understand that the present disclosure can be incorporated in other specific forms without modifying the technical concepts or essential characteristics of the present disclosure . In this regard, the exemplary modalities disclosed in this document are for illustrative purposes only and should not be construed as limiting the scope of the present disclosure. On the contrary, the present disclosure is intended to cover not only the exemplary modalities, but also various alternatives, modifications, equivalents, and other modalities that may be included within the spirit and scope of the present disclosure as defined by the appended claims.
    权利要求:
    Claims (8)
    [1]
    1. Adenyl succinate synthase variant characterized by the 85 s amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 2 being replaced by a different amino acid.
    [2]
    2. Adenyl succinate synthase variant according to claim 1, characterized in that the different amino acid is selected from the group consisting of serine, alanine, valine, leucine, methionine, isoleucine, threonine, asparagine, glutamine, cysteine, tyrosine, lysine, aspartic acid and glutamic acid.
    [3]
    3. Polynucleotide characterized by encoding the adenyl succinate synthase variant according to claim 1.
    [4]
    Vector characterized by comprising the polynucleotide according to claim 3.
    [5]
    5. Microorganism of the genus Corynebacterium characterized by producing purine nucleotides comprising the variant of adenyl succinate synthetase, according to claim 1, or the vector, according to claim 4.
    [6]
    6. Microorganism according to claim 5, characterized in that the microorganism of the genus Corynebacterium is Corynebacterium station is.
    [7]
    7. Method for preparing purine nucleotides characterized by comprising:
    cultivating the microorganism of the genus Corynebacterium, according to claim 5, in a medium; and recovering the purine nucleotides from the microorganism or medium.
    [8]
    8. Method according to claim 7, characterized in that the microorganism of the genus Corynebacterium is Corynebacterium stationis.
    类似技术:
    公开号 | 公开日 | 专利标题
    BR112019014131A2|2020-03-10|ADENYL SUCCINATE SYNTHETASE VARIANT, POLYNUCLEOTIDE, VECTOR, MICROORGANISM OF THE CORYNEBACTERIUM GENDER AND METHOD FOR PREPARING PURINE NUCLEOTIDS
    US11041181B2|2021-06-22|Promoter and method for producing purine nucleotide using the same
    RU2725193C1|2020-06-30|Novel polypeptide and method for producing imp using said polypeptide
    BR122020018773B1|2021-06-22|MODIFIED POLYPEPTIDE HAVING CITRATE SYNTASE ACTIVITY, CORYNEBACTERIUM GENDER MICROORGANISM AND METHOD TO PRODUCE AN L-AMINO ACID
    BR112019020697A2|2021-02-17|modified homoserine dehydrogenase and method for the production of homoserine or homoserine-derived l-amino acid that uses the same
    BR112020001762A2|2020-07-21|variant of atp phosphoribosyltransferase, polynucleotide, vector, microorganism of the genus corynebacterium, and method for producing histidine.
    US11008599B2|2021-05-18|Variant phosphoribosylpyrophosphate amidotransferase and method of preparing purine nucleotide using the same
    TWI710634B|2020-11-21|Novel 5'-inosinic acid dehydrogenase and method of preparing 5'-inosinic acid using the same
    BR112020004575A2|2020-09-24|polynucleotide, vector, microorganism of the genus corynebacterium, methods for producing target substance and for preparing a fermented composition, and fermented composition.
    CA3050149A1|2020-02-01|Novel adenylosuccinate synthetase and method for producing purine nucleotides using the same
    BR112019014101A2|2020-03-03|PROTEIN VARIANT THAT HAS AN EXPORT ACTIVITY OF INOSIN-5'-MONOPHOSPHATE, POLYNUCLEOTIDE, VECTOR, MICRO-ORGANISM OF THE GENERY CORYNEBACTERIUM THAT PRODUCES INOSINE-5'-MONOPHOSPHATE, METHOD OF PREPARING THE INHESIS OF PHOSPHATE PROTEIN
    BR112019021322A2|2020-09-15|glucoamylase variant, methods for increasing the crude starch hydrolysis activity of a glucoamylase and for producing a glucoamylase variant, composition, use of a glucoamylase variant, processes for producing a fermentation product and for producing a syrup product, polynucleotide encoding the glucoamylase variant, nucleic acid construct, expression vector, and host cell
    同族专利:
    公开号 | 公开日
    US11236321B2|2022-02-01|
    JP2020535787A|2020-12-10|
    ZA201904757B|2020-03-25|
    US20200392478A1|2020-12-17|
    JP6805353B2|2020-12-23|
    SG11201906527WA|2020-03-30|
    WO2020027362A1|2020-02-06|
    CN111212904B|2021-04-23|
    KR101950141B1|2019-02-19|
    AU2018402495A1|2020-02-20|
    EP3831938A1|2021-06-09|
    CN111212904A|2020-05-29|
    TW202012428A|2020-04-01|
    TWI734995B|2021-08-01|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    KR101166027B1|2009-04-01|2012-07-19|씨제이제일제당 |Microorganism belonging to the genus Corynebacterium having enhaced 5'-inosinic acid productivity and method for producing 5'-inosinic acid using the same|
    JP5790022B2|2010-06-29|2015-10-07|味の素株式会社|Xylanase and gene encoding the same|
    CN103952419B|2014-04-15|2016-06-29|天津大学|Bacillus subtilis adenosine succinic acid synthase mutant gene purA and application|
    CN106906174B|2015-12-23|2019-10-25|中国科学院微生物研究所|Produce the recombinant bacterium and the preparation method and application thereof of inosine|KR102006976B1|2019-02-26|2019-08-06|씨제이제일제당 주식회사|Novel promoter and method for producing purine nucleotide using the same|
    KR102006977B1|2019-03-28|2019-08-05|씨제이제일제당 주식회사|Modified phosphoribosylpyrophosphate amidotransferase and method for producing purine nucleotide using the same|
    KR102185850B1|2020-02-21|2020-12-02|씨제이제일제당 주식회사|Microorganisms that produce purine nucleotides and methods of producing purine nucleotides using the same|
    KR102254632B1|2021-01-15|2021-05-21|씨제이제일제당 주식회사|Novel Phytoene desaturase variant and a method for producing IMP using the same|
    KR102254631B1|2021-01-15|2021-05-21|씨제이제일제당 주식회사|Novel Peptide methionine sulfoxide reductase variant and a method for producing IMP using the same|
    KR102259339B1|2021-01-15|2021-06-01|씨제이제일제당 주식회사|Novel aldehyde dehydrogenase variant and a method for producing XMP or GMP using the same|
    KR102254634B1|2021-01-15|2021-05-21|씨제이제일제당 주식회사|Novel formamidopyrimidine-DNA glycosylase variant and a method for producing IMP using the same|
    KR102254629B1|2021-01-15|2021-05-21|씨제이제일제당 주식회사|Novel Glucosamine-6-phosphate deaminase variant and a method for producing IMP using the same|
    KR102259338B1|2021-01-15|2021-06-01|씨제이제일제당 주식회사|Novel 2,5-diketo-D-gluconic acid reductase variant and a method for producing XMP or GMP using the same|
    KR102266232B1|2021-01-15|2021-06-17|씨제이제일제당 주식회사|Novel polyketide synthase variant and a method for producing XMP or GMP using the same|
    KR102259337B1|2021-01-15|2021-06-01|씨제이제일제당 주식회사|Novel phosphonoacetate hydrolase variant and a method for producing XMP or GMP using the same|
    KR102254633B1|2021-01-15|2021-05-21|씨제이제일제당 주식회사|Novel 3D--trihydroxycyclohexane-1,2-dione acylhydrolase variant and a method for producing IMP using the same|
    KR102288395B1|2021-01-15|2021-08-10|씨제이제일제당 주식회사|Novel 1,4-alpha-glucan-branching enzyme variant and a method for producing IMP using the same|
    KR102274483B1|2021-01-29|2021-07-07|씨제이제일제당 주식회사|Novel 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase variant and a method for producing XMP or GMP using the same|
    KR102288398B1|2021-01-29|2021-08-10|씨제이제일제당 주식회사|Novel NAD-dependent oxidoreductase variant and a method for producing XMP or GMP using the same|
    KR102273637B1|2021-01-29|2021-07-06|씨제이제일제당 주식회사|Novel Peptidyl-dipeptidase variant and a method for producing XMP or GMP using the same|
    KR102273638B1|2021-04-20|2021-07-06|씨제이제일제당 주식회사|Novel Phosphoglycerate dehydrogenase variant and a method for producing XMP or GMP using the same|
    KR102279696B1|2021-04-20|2021-07-20|씨제이제일제당 주식회사|Novel L-serine ammonia-lyase variant and a method for producing XMP or GMP using the same|
    KR102274484B1|2021-04-20|2021-07-07|씨제이제일제당 주식회사|Novel F0F1 ATP synthase subunit alpha variant and a method for producing XMP or GMP using the same|
    KR102273639B1|2021-04-20|2021-07-06|씨제이제일제당 주식회사|Novel bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase variant and a method for producing XMP or GMP using the same|
    KR102273640B1|2021-04-20|2021-07-06|씨제이제일제당 주식회사|Novel F0F1 ATP synthase subunit gamma variant and a method for producing XMP or GMP using the same|
    法律状态:
    2021-08-17| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|
    2021-10-13| B350| Update of information on the portal [chapter 15.35 patent gazette]|
    2021-10-26| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|
    2022-02-08| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|
    优先权:
    申请号 | 申请日 | 专利标题
    KR10-2018-0089855|2018-08-01|
    KR1020180089855A|KR101950141B1|2018-08-01|2018-08-01|Novel adenylosuccinate synthetase and method for producing purine nucleotide using the same|
    PCT/KR2018/009714|WO2020027362A1|2018-08-01|2018-08-23|Novel adenylosuccinate synthetase and method for producing purine nucleotide using same|
    [返回顶部]